Detail Information of hs0000481 [Genome Browser]
1.Basic Information

Name: hs0000481
Species: Homo sapiens
Cell Line: Mononuclear cells
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: 12
Test repetition: at least t
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IL1B,segment 35L 2:113590922-113598812 ACCGCACAAACAGTAAATGCT +
Target
Locus2 Fragment location Primer sequence Strand
IL1A,segment 26R 2:113548783-113549895 TGGCCCATAAAACCTCTGG -

4.Reference

Sharaf, N., et al. (2014). "Long-range DNA interactions at the IL-1/IL-36/IL-37 gene cluster (2q13) are induced by activation of monocytes." Cytokine 68(1): 16-22.   PMID: 24787052

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.