Detail Information of hs0000475 [Genome Browser]
1.Basic Information

Name: hs0000475
Species: Homo sapiens
Cell Line: KG1a
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: treatment CD34+
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CD34,promoter 1:208081977-208089431 CTGGCAAGAACATCTAAGGATAG +
Target
Locus2 Fragment location Primer sequence Strand
CD34,downstream regulatory element 1:208039188-208044175 TCCAGTCTCCACATCTGCTG +

4.Reference

Levantini, E., et al. (2011). "RUNX1 regulates the CD34 gene in haematopoietic stem cells by mediating interactions with a distal regulatory element." EMBO J 30(19): 4059-4070.   PMID: 21873977

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.