Detail Information of hs0000471 [Genome Browser]
1.Basic Information

Name: hs0000471
Species: Homo sapiens
Cell Line: Huh7
Restriction Enzyme: BstYI

2.Experiment Infromation

Remark: control: nearby locus; PXR-dependent;HNF4aas a key PXR target for repression of promoter activity
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
SULT1E1,promoter 4:70725827-70727702 TCACCAGAAACATTCCAAATGCAG -
Target
Locus2 Fragment location Primer sequence Strand
SULT1E1,enhancer 4:70725827-70727702 CTGAAACCTCATTCTTCTCCATGA +

4.Reference

Kodama, S., et al. (2011). "Liganded pregnane X receptor represses the human sulfotransferase SULT1E1 promoter through disrupting its chromatin structure." Nucleic Acids Res 39(19): 8392-8403.   PMID: 21764778

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.