Detail Information of hs0000457 [Genome Browser]
1.Basic Information

Name: hs0000457
Species: Homo sapiens
Cell Line: IMR90
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: no treatment or with TNF-α
Primer amount: 9
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
ACAT2 6:160182279-160187809 TCTGAGCTTTCTAGGGTTTCCA -
Target
Locus2 Fragment location Primer sequence Strand
ACAT2,distal promoter tethered region 1 6:160112133-160120292 ACTTGTGGAATCAGAGCCTTACT -

4.Reference

Jin, F., et al. (2013). "A high-resolution map of the three-dimensional chromatin interactome in human cells." Nature 503(7475): 290-294.   PMID: 24141950

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.