Detail Information of hs0000446 [Genome Browser]
1.Basic Information

Name: hs0000446
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: BfaI & EcoRI

2.Experiment Infromation

Remark: in decoy ZF-Sss1-expressing MCF7 cells
Primer amount: 8
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IGF2,promoter P2,segment 1b 11:2163633-2163791 TGCACACTCCCTATCACAAAATCTGAAAATTCCTG -
Target
Locus2 Fragment location Primer sequence Strand
IGF2,promoter P3,2b 11:2160913-2161631 CTGCCTGCCCGGAGACCCCAGCTCACGA -

4.Reference

Zhang, H., et al. (2011). "Interruption of intrachromosomal looping by CCCTC binding factor decoy proteins abrogates genomic imprinting of human insulin-like growth factor II." J Cell Biol 193(3): 475-487.   PMID: 21536749

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.