Detail Information of hs0000445 [Genome Browser]
1.Basic Information

Name: hs0000445
Species: Homo sapiens
Cell Line: LNCaP
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 30
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
SOX9,enhancer,segment E1 17:69105438-69109150 GCCCAGCATCCTATACGTGA +
Target
Locus2 Fragment location Primer sequence Strand
SOX9,promoter 17:70121329-70122408 AGGCAGGAGGAAATGCACTA -

4.Reference

Zhang, X., et al. (2012). "Integrative functional genomics identifies an enhancer looping to the SOX9 gene disrupted by the 17q24.3 prostate cancer risk locus." Genome Res 22(8): 1437-1446.   PMID: 22665440

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.