Detail Information of hs0000444 [Genome Browser]
1.Basic Information

Name: hs0000444
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HMOX1,enhancer,+220bp segment 22:35777515-35780142 GCTAGTGAGGGACAGATGCCACCAAG -
Target
Locus2 Fragment location Primer sequence Strand
HMOX1,promoter,-4.5kb segment 22:35771433-35774214 GAAAGCAAGCCCAGACCGGCAGC +

4.Reference

Kim, J., et al. (2012). "In vivo regulation of the heme oxygenase-1 gene in humanized transgenic mice." Kidney Int 82(3): 278-291.   PMID: 22495295

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.