Detail Information of hs0000438 [Genome Browser]
1.Basic Information

Name: hs0000438
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: c-Myb binding; the same when knock MYB expression
Primer amount: 7
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
LMO2,promoter 11:33913203-33917307 GAGCCAGAAGAAGTGGTGATTA -
Target
Locus2 Fragment location Primer sequence Strand
CAT,promoter 11:34459688-34467291 TTAAACACTGGAGAAATCTGCTT -

4.Reference

Lorenzo, P. I., et al. (2011). "Identification of c-Myb Target Genes in K562 Cells Reveals a Role for c-Myb as a Master Regulator." Genes Cancer 2(8): 805-817.   PMID: 22393465

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.