Detail Information of hs0000437 [Genome Browser]
1.Basic Information

Name: hs0000437
Species: Homo sapiens
Cell Line: PFC
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 8
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
DPP10,segment primer2 16:21511275-21518865 TCTTTGTCGGAATCCACTCGGTACACACAC +
Target
Locus2 Fragment location Primer sequence Strand
DPP10,segment primer7 16:22447033-22450608 CAAGTGCTTTATTTCTTGGCTCTGGGGAGG +

4.Reference

Shulha, H. P., et al. (2012). "Human-specific histone methylation signatures at transcription start sites in prefrontal neurons." PLoS Biol 10(11): e1001427.   PMID: 23185133

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.