Detail Information of hs0000420 [Genome Browser]
1.Basic Information

Name: hs0000420
Species: Homo sapiens
Cell Line: hMSC
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: SF-1 binding, also in HEK293,hTERT-E6/E7 cells
Primer amount: 9
Test repetition: at least t
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
GSTA1,promoter 6:52667963-52669922 CATATTCTGTCTCTGGAGTTCTACCAA -
Target
Locus2 Fragment location Primer sequence Strand
GSTA3,promoter 6:52667963-52669922 TGGCCAATATAGAGGATAGCTAAGA -

4.Reference

Matsumura, T., et al. (2013). "Human glutathione S-transferase A (GSTA) family genes are regulated by steroidogenic factor 1 (SF-1) and are involved in steroidogenesis." FASEB J 27(8): 3198-3208.   PMID: 23650189

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.