Detail Information of hs0000374 [Genome Browser]
1.Basic Information

Name: hs0000374
Species: Homo sapiens
Cell Line: MDECs
Restriction Enzyme: BbvCI

2.Experiment Infromation

Remark: control:treatment; Estrogen-mediated epigenetic repression of large chromosomal regions through DNA looping
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
16p11.2 gene cluster,ESR1 binding site 1 16:29788765-29790628 ESR1-1-P1: TGCTCTTTTCTTCCCACTCCAGCCC/ESR1-1-C1 TGCCTGGGTCAATCAAGTCAA +
Target
Locus2 Fragment location Primer sequence Strand
16p11.2 gene cluster,segment BbvCI 4 16:29788765-29793002 AGGCACAGAGAAGGGCTAGGA -

4.Reference

Hsu, P. Y., et al. (2010). "Estrogen-mediated epigenetic repression of large chromosomal regions through DNA looping." Genome Res 20(6): 733-744.   PMID: 20442245

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.