Detail Information of hs0000361 [Genome Browser]
1.Basic Information

Name: hs0000361
Species: Homo sapiens
Cell Line: NeHepLxHT
Restriction Enzyme: DpnII

2.Experiment Infromation

Remark: under TNF treatment, TC3 is higher in fig
Primer amount: 8
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
LTB,TE2 6:31546202-31546827 CCAGGGCCCTAGGAGTCTAA -
Target
Locus2 Fragment location Primer sequence Strand
TNF 6:31541988-31543539 AGCTGGCTTTCAGAGCCTTT -

4.Reference

Watanabe, T., et al. (2012). "Higher-order chromatin regulation and differential gene expression in the human tumor necrosis factor/lymphotoxin locus in hepatocellular carcinoma cells." Mol Cell Biol 32(8): 1529-1541.   PMID: 22354988

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.