Detail Information of hs0000356 [Genome Browser]
1.Basic Information

Name: hs0000356
Species: Homo sapiens
Cell Line: FRDA
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: patient-derived cells (GM16798, GM15850 and GM16234)
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
FXN,GAA region 9:71647888-71656092 ACCCAGTGGCTGGTATTTTG +
Target
Locus2 Fragment location Primer sequence Strand
FXN 9:71679213-71680812 CAGACTCTTCCCACGCATCT -

4.Reference

Chan, P. K., et al. (2013). "Heterochromatinization induced by GAA-repeat hyperexpansion in Friedreich's ataxia can be reduced upon HDAC inhibition by vitamin B3." Hum Mol Genet 22(13): 2662-2675.   PMID: 23474817

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.