Detail Information of hs0000354 [Genome Browser]
1.Basic Information

Name: hs0000354
Species: Homo sapiens
Cell Line: HEMn-DP
Restriction Enzyme: ApoI

2.Experiment Infromation

Remark: melanocyte-specific
Primer amount: 12
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
OCA2,promoter 15:28343357-28346841 ACCTGAACACAGAGATGAAAGAGC -
Target
Locus2 Fragment location Primer sequence Strand
HERC2,rs12913832 15:28366120-28366602 CCGCTGCTGTTACATTGGGA -

4.Reference

Visser, M., et al. (2012). "HERC2 rs12913832 modulates human pigmentation by attenuating chromatin-loop formation between a long-range enhancer and the OCA2 promoter." Genome Res 22(3): 446-455.   PMID: 22234890

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.