Detail Information of hs0000341 [Genome Browser]
1.Basic Information

Name: hs0000341
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: BamHI/EcoRI

2.Experiment Infromation

Remark: treatment: siGATA3 E2/Veh
Primer amount: 11
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
TFF,segment 8 21:43795839-43798917 AGAGAGGAGGCTGTGGAAGTTAGTG -
Target
Locus2 Fragment location Primer sequence Strand
TFF,segment 10 21:43808790-43809326 GGGGAGACCACATAAGCAATAAGAT -

4.Reference

Theodorou, V., et al. (2013). "GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility." Genome Res 23(1): 12-22.   PMID: 23172872

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.