Detail Information of hs0000034 [Genome Browser]
1.Basic Information

Name: hs0000034
Species: Homo sapiens
Cell Line: Y79
Restriction Enzyme: BpmI

2.Experiment Infromation

Remark: CRX expression vector
Primer amount: 7
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
RHO,enhancer 3:129245266-129245754 GCGTTGGGCATAATCACCAG +
Target
Locus2 Fragment location Primer sequence Strand
RHO,segment E3 3:129250405-129251339 TAGCAAGACTGAGGAGGAAAGG -

4.Reference

Peng, G. H. and S. Chen (2011). "Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network." Proc Natl Acad Sci USA 108(43): 17821-17826.   PMID: 22006320

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.