Detail Information of hs0000030 [Genome Browser]
1.Basic Information

Name: hs0000030
Species: Homo sapiens
Cell Line: A549
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: 8
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
SNAI1,ncRNA,segment a7 20:48653626-48661831 CTAGGTCAGGCCCAAAGAGA -
Target
Locus2 Fragment location Primer sequence Strand
SNAI1,segment s4 20:48587014-48597692 ATTGGCAAGAAGGGGAAAAT -

4.Reference

Lai, F., et al. (2013). "Activating RNAs associate with Mediator to enhance chromatin architecture and transcription." Nature 494(7438): 497-501.   PMID: 23417068

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.