Detail Information of hs0000290 [Genome Browser]
1.Basic Information

Name: hs0000290
Species: Homo sapiens
Cell Line: COLO829
Restriction Enzyme: ApoI

2.Experiment Infromation

Remark: with controls
Primer amount: 6
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MET,enhancer,+63kb segment 7:116374378-116375502 CACCCACTCATCACTCCTGTT +
Target
Locus2 Fragment location Primer sequence Strand
MET,promoter 7:116311695-116313089 AGCCGAGCTGTTTCCTTGTT +

4.Reference

Webster, D. E., et al. (2014). "Enhancer-targeted genome editing selectively blocks innate resistance to oncokinase inhibition." Genome Res 24(5): 751-760.   PMID: 24443471

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.