Detail Information of hs0000288 [Genome Browser]
1.Basic Information

Name: hs0000288
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: E2-induced
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
P2RY2,ERBS1 11:72900568-72911730 CCATCAAAGCTGTTGCTTCT +
Target
Locus2 Fragment location Primer sequence Strand
P2RY2,segment a 11:72935984-72942281 Outer:GCAGGAGGATTTCAAGTA/Inner:AGCAACAAGAGGTAGAGC +

4.Reference

Hah, N., et al. (2013). "Enhancer transcripts mark active estrogen receptor binding sites." Genome Res 23(8): 1210-1223.   PMID: 23636943

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.