Detail Information of hs0000285 [Genome Browser]
1.Basic Information

Name: hs0000285
Species: Homo sapiens
Cell Line: LNCaP
Restriction Enzyme: BstYI

2.Experiment Infromation

Remark: NA
Primer amount: 10
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
KLK3,enhancer 19:51351733-51354188 TCGATTGTCCTTGACAGTAAACA +
Target
Locus2 Fragment location Primer sequence Strand
KLK2,promoter,segment D 19:51373972-51375333 ACCCTTGACCTCCTGGACTT +

4.Reference

Hsieh, C. L., et al. (2014). "Enhancer RNAs participate in androgen receptor-driven looping that selectively enhances gene activation." Proc Natl Acad Sci USA.   PMID: 24778216

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.