Detail Information of hs0000028 [Genome Browser]
1.Basic Information

Name: hs0000028
Species: Homo sapiens
Cell Line: HeLa
Restriction Enzyme: NcoI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CIITA, +59kb segment,IRF1 16:11027443-11033290 ATGGGATTGTGTCATCTCCTGCCTAGA +
Target
Locus2 Fragment location Primer sequence Strand
CIITA,-8kb segmtn, IRF1 16:10960422-10965212 GTGCATGGTGGAAAGATGACTGTAAGT +

4.Reference

Abou El Hassan, M. and R. Bremner (2009). "A rapid simple approach to quantify chromosome conformation capture." Nucleic Acids Res 37(5): e35.   PMID: 19181703

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.