Detail Information of hs0000024 [Genome Browser]
1.Basic Information

Name: hs0000024
Species: Homo sapiens
Cell Line: REX
Restriction Enzyme: NlaIII

2.Experiment Infromation

Remark: only in the primary T-ALL patient’s BM and in the patient-derived primary T-ALL cells
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
TAL1,promoter 1 1:47690027-47699198 CACTCCCTCCGGTGAAATTG +
Target
Locus2 Fragment location Primer sequence Strand
CD2BP2,TIL16 16:30343559-30357326 GAGACCCAGAAAGAGGAA NA

4.Reference

Patel, B., et al. (2014). "Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia." Leukemia 28(2): 349-361.   PMID: 23698277

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.