Detail Information of hs0000238 [Genome Browser]
1.Basic Information

Name: hs0000238
Species: Homo sapiens
Cell Line: pituitary
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: sucrose control/DOX-treated mice
Primer amount: 23
Test repetition: two
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
GH1,promoter 17:61994830-61997428 AAAGATGCCCTGTCCAGCCA +
Target
Locus2 Fragment location Primer sequence Strand
CD79B,HSV 17:62023788-62040286 GAACGGCAGGGTGGAGAGGC +

4.Reference

Ho, Y., et al. (2013). "Distinct chromatin configurations regulate the initiation and the maintenance of hGH gene expression." Mol Cell Biol 33(9): 1723-1734.   PMID: 23428872

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.