Detail Information of hs0000237
1.Basic Information

Name: hs0000237
Species: Homo sapiens
Cell Line: pituitary
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: sucrose control/DOX-treated mice
Primer amount: 23
Test repetition: two
Reliability Level: NA

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
hGH-N promoter(the hGH locus) 17:61994830-61997428 AAAGATGCCCTGTCCAGCCA +
Target
Locus2 Fragment location Primer sequence Strand
CD79B,HSI,segment II NA NA NA

4.Reference

Ho, Y., et al. (2013). "Distinct chromatin configurations regulate the initiation and the maintenance of hGH gene expression." Mol Cell Biol 33(9): 1723-1734.   PMID: 23428872

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.