Detail Information of hs0000224 [Genome Browser]
1.Basic Information

Name: hs0000224
Species: Homo sapiens
Cell Line: HK-2
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HMOX1,220bp intronic enhancer 22:35777515-35780142 GCTAGTGAGGGACAGATGCCACCAAG -
Target
Locus2 Fragment location Primer sequence Strand
HMOX1,promoter,-4.0 kb HS-2 region 22:35771433-35774214 GAAAGCAAGCCCAGACCGGCAGC +

4.Reference

Deshane, J., et al. (2010). "Sp1 regulates chromatin looping between an intronic enhancer and distal promoter of the human heme oxygenase-1 gene in renal cells." Journal of Biological Chemistry 285(22): 16476-16486.   PMID: 20351094

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.