Detail Information of hs0000218 [Genome Browser]
1.Basic Information

Name: hs0000218
Species: Homo sapiens
Cell Line: U2OS
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: conrol: nearby locus
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
rRNA gene,promoter :106717-106736 Promoter (right): GCGCAGGTGTTTCCTCGTAC/Promoter (left) GAGAAGACACAGTTGCCCCAG NA
Target
Locus2 Fragment location Primer sequence Strand
rRNA gene,coding region :109510-109529 AGAGGGAGCCTGAGAAACGG +

4.Reference

Denissov, S., et al. (2011). "A model for the topology of active ribosomal RNA genes." EMBO Rep 12(3): 231-237.   PMID: 21331097

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.