Detail Information of hs0000195 [Genome Browser]
1.Basic Information

Name: hs0000195
Species: Homo sapiens
Cell Line: SK-N-SH
Restriction Enzyme: PstI

2.Experiment Infromation

Remark: NA
Primer amount: 6
Test repetition: four
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PCDHA8,promoter,segment CSE(P1) 5:140221246-140222469 GAGTCTGGCATTCTGGATTCTG -
Target
Locus2 Fragment location Primer sequence Strand
PCDHA,HS5-1a,segment P3 5:140419728-140420816 CTTGGAACCAGTTGGGATTG +

4.Reference

Guo, Y., et al. (2012). "CTCF/cohesin-mediated DNA looping is required for protocadherin alpha promoter choice." Proc Natl Acad Sci USA 109(51): 21081-21086.   PMID: 23204437

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.