Detail Information of her0000007
1.Basic Information

Name: her0000007
Species: Herpesviru
Cell Line: BCBL-1
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: conrol: ligase;CTCF-dependence
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
KSHV,site 129211,CTCF :129180-129200 TAGGACAGAAAGGTCACCTGG +
Target
Locus2 Fragment location Primer sequence Strand
KSHV,site 72818,CTCF :72818-72838 KSHV_72818-72838-F: TCTCGAATGAGGACCAAAGGC NA

4.Reference

Kang, H., et al. (2011). "Coordination of KSHV latent and lytic gene control by CTCF-cohesin mediated chromosome conformation." PLoS Pathog 7(8): e1002140.   PMID: 21876668

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.