Detail Information of rn0000001 [Genome Browser]
1.Basic Information

Name: rn0000001
Species: Rattus norvegicus
Cell Line: T cells
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: fixed fragment containing the predicted Fbxo10/FBXO10 promoter
Primer amount: 24
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
FBXO10,promoter,MCS5A1 5:60645994-60645971 AGGCAGTTCTTAGAAGCAAGTTCA -
Target
Locus2 Fragment location Primer sequence Strand
TOMM5,+8kb segment,MCS5A2 5:60645918-60650007 AAAGGGACTATGTTATTTGGGCAAG -

4.Reference

Smits, B. M., et al. (2012). "An insulator loop resides between the synthetically interacting elements of the human/rat conserved breast cancer susceptibility locus MCS5A/Mcs5a." Nucleic Acids Res 40(1): 132-147.   PMID: 21914726

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.