Detail Information of sv-mac0000003
1.Basic Information

Name: sv-mac0000003
Species: Sendai viru-Macaca mulatta
Cell Line: COS-7
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: SeV-Monkey: cotransfect plasmids encoding the SV40 into a monkey.
Primer amount: NA
Test repetition: four
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
aldoa,segment 1 20:28158628-28158647 AAATTTCCTCTGAAGCACCG +
Target
Locus2 Fragment location Primer sequence Strand
aldoa,segment 2 20:28046455-28046473 TTAATGGGGCATCAAGCAC -

4.Reference

Xu, M. and P. R. Cook (2008). "Similar active genes cluster in specialized transcription factories." J Cell Biol 181(4): 615-623.   PMID: 18490511

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.