Detail Information of at0000006
1.Basic Information

Name: at0000006
Species: Arabidopsis thaliana
Cell Line: Arabidopsis thaliana
Restriction Enzyme: Sau3AI

2.Experiment Infromation

Remark: mock-treated (Mock)
Primer amount: 9
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
TFL1,TSS,segment A 5:1026282-1026305 CGTTAGTGGGTTTTGTTCTTCGTG -
Target
Locus2 Fragment location Primer sequence Strand
MADS-box regulators binding region(D) 5:1023240-1023263 ATGGCACATGTGTAGATAACCCTT +

4.Reference

Liu, C., et al. (2013). "A conserved genetic pathway determines inflorescence architecture in Arabidopsis and rice." Dev Cell 24(6): 612-622.   PMID: 23537632

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.