Detail Information of at0000003
1.Basic Information

Name: at0000003
Species: Arabidopsis thaliana
Cell Line: seedlings
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: vernalization
Primer amount: 6
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
FLC,segment FIV 5:3173189-3173208 CTTCCGTAGTTCCGTCATCC -
Target
Locus2 Fragment location Primer sequence Strand
FLC,segment FI 5:3178777-3178796 CGTGCTCGATGTTGTTGAGT -

4.Reference

Crevillen, P., et al. (2013). "A gene loop containing the floral repressor FLC is disrupted in the early phase of vernalization." EMBO J 32(1): 140-148.   PMID: 23222483

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.