Detail Information of at0000001
1.Basic Information

Name: at0000001
Species: Arabidopsis thaliana
Cell Line: seedlings
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: Col, Col-FRI and fcafpa
Primer amount: 6
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
FLC,segment FI 5:3178777-3178796 CGTGCTCGATGTTGTTGAGT -
Target
Locus2 Fragment location Primer sequence Strand
FLC,segment FV 5:3172601-3172621 AAGGCAACACAAACTTTCTCG -

4.Reference

Crevillen, P., et al. (2013). "A gene loop containing the floral repressor FLC is disrupted in the early phase of vernalization." EMBO J 32(1): 140-148.   PMID: 23222483

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.