Detail Information of zm0000002
1.Basic Information

Name: zm0000002
Species: Zea mays
Cell Line: inner stem and husk tissue
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: tissue-specific
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
b1,TSS,segment I 2:19040840-19040861 CTCCTCAATTTGCGTTTTACTC -
Target
Locus2 Fragment location Primer sequence Strand
b1,-47kb segment VII :45503-45521 AGGATGCTAGAGTCCCAGC NA

4.Reference

Louwers, M., et al. (2009). "Tissue- and expression level-specific chromatin looping at maize b1 epialleles." Plant Cell 21(3): 832-842.   PMID: 19336692

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.