Detail Information of ci0000004 [Genome Browser]
1.Basic Information

Name: ci0000004
Species: Ciona intestinalis
Cell Line: embryo cells
Restriction Enzyme: NlaIII

2.Experiment Infromation

Remark: on the figure
Primer amount: 19
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Pinhead,promoter,segment 5 02q:2258249-2258271 GCGACAATCAACAGACTTTTGCT -
Target
Locus2 Fragment location Primer sequence Strand
Pinhead,segment 12 02q:2261279-2261300 CAGAAAGCTCTGGCGAAAATGC -

4.Reference

Imai, K. S., et al. (2012). "Cis-acting transcriptional repression establishes a sharp boundary in chordate embryos." Science 337(6097): 964-967.   PMID: 22923581

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.