Detail Information of hs0000019 [Genome Browser]
1.Basic Information

Name: hs0000019
Species: Homo sapiens
Cell Line: KG-1
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 7
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IGF1R, promoter,segment h2',JH764 15:99191268-99194982 GCTGGGAGAGGTTCATTGAAAACA -
Target
Locus2 Fragment location Primer sequence Strand
IGF1R,enhancer,segment p',JH766 15:99336799-99339997 CAGTGAAAGGGATTTGAGGCAAAA -

4.Reference

Sun, J., et al. (2014). "A novel antisense long noncoding RNA within the IGF1R gene locus is imprinted in hematopoietic malignancies." Nucleic Acids Res 42(15): 9588-9601.   PMID: 25092925

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.