Detail Information of ec0000033
1.Basic Information

Name: ec0000033
Species: Escherichia coli
Cell Line: E. coli(K-12 MG1655)
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: reduced upon hnsdeletion; Because all control pairs showed crosslinking frequencies < 2 , we designated 2 as the background value
Primer amount: 9
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
gltF H-NS,segmnt B :3360678-3360701 ATGCCGCATTTGCCAGAAAACAAC -
Target
Locus2 Fragment location Primer sequence Strand
fliA H-NS,segment D :2001935-2001958 CGCAATTTGTCAGCAACGTGCTTC -

4.Reference

Wang, W., et al. (2011). "Chromosome organization by a nucleoid-associated protein in live bacteria." Science 333(6048): 1445-1449.   PMID: 21903814

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.