Detail Information of ec0000004
1.Basic Information

Name: ec0000004
Species: Escherichia coli
Cell Line: E.coli
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: cross-linked, weaker in ΔgalR
Primer amount: 26
Test repetition: four
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
GalR for mgl/galS,segment P14 :2238640-2239801 ACAACCAGGCGAAAGCGACCTTTGATCT NA
Target
Locus2 Fragment location Primer sequence Strand
GalR for galR,segment P24 :2974591-2974606 GCGCGGCATTCCACAGACCATAATAATG NA

4.Reference

Qian, Z., et al. (2012). "Galactose repressor mediated intersegmental chromosomal connections in Escherichia coli." Proc Natl Acad Sci USA 109(28): 11336-11341.   PMID: 22733746

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.