Detail Information of dm0000060 [Genome Browser]
1.Basic Information

Name: dm0000060
Species: Drosophila melanogaster
Cell Line: embryo cells
Restriction Enzyme: EcoRI/MfeI

2.Experiment Infromation

Remark: After a 3 h ecdysone treatment, increase;CBP or JIL-1 knockdown, decrease; treated with ecdysone and lacking 14-3-3,decrease
Primer amount: 20
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
scs' 3R:11962738-11963819 GTGCGACGAATTAACATATTTTCA +
Target
Locus2 Fragment location Primer sequence Strand
scs 3R:7772873-7778066 GGTGGCAAATGAACTGC +

4.Reference

Kellner, W. A., et al. (2012). "Genome-wide phosphoacetylation of histone H3 at Drosophila enhancers and promoters." Genome Res 22(6): 1081-1088.   PMID: 22508764

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.