Detail Information of dm0000041 [Genome Browser]
1.Basic Information

Name: dm0000041
Species: Drosophila melanogaster
Cell Line: Kc167
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: Tollrm9/Tollrm10
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Eip75B-RB,enhancer 3L:18012415-18026000 GCCATTCACTTGCACCAGTTAG +
Target
Locus2 Fragment location Primer sequence Strand
Eip75B-RB,promoter 3L:18057511-18061284 TCGTATGGCCAACAGCTGAGGGT +

4.Reference

Chopra, V. S., et al. (2012). "Transcriptional repression via antilooping in the Drosophila embryo." Proc Natl Acad Sci USA 109(24): 9460-9464.   PMID: 22645339

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.