Detail Information of dm0000019 [Genome Browser]
1.Basic Information

Name: dm0000019
Species: Drosophila melanogaster
Cell Line: S2
Restriction Enzyme: DpnII

2.Experiment Infromation

Remark: absence of hormone
Primer amount: 24
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
E75A,promoter 3L:17999535-17999646 CTTTGCACTCTCTCGCACTTC +
Target
Locus2 Fragment location Primer sequence Strand
EcREs,-2.5kb segment 2 3L:18002016-18002652 TTCATGATGTCATGGCGAAG +

4.Reference

Bernardo, T. J., et al. (2014). "A view through a chromatin loop: insights into the ecdysone activation of early genes in Drosophila." Nucleic Acids Res 42(16): 10409-10424.   PMID: 25143532

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.