Detail Information of dm0000010 [Genome Browser]
1.Basic Information

Name: dm0000010
Species: Drosophila melanogaster
Cell Line: S2
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: treatment: ecdysone(stronger in presence of ecdysone)
Primer amount: 23
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
E75C,promoter 3L:18057828-18065524 GACATCTGTAGCTTAGTGTAAAAGTGG -
Target
Locus2 Fragment location Primer sequence Strand
EcREs,-30kb segment 7 3L:18030813-18032878 GCACAGTTGTGACCTAATGACC -

4.Reference

Bernardo, T. J., et al. (2014). "A view through a chromatin loop: insights into the ecdysone activation of early genes in Drosophila." Nucleic Acids Res 42(16): 10409-10424.   PMID: 25143532

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.