Detail Information of dm0000003 [Genome Browser]
1.Basic Information

Name: dm0000003
Species: Drosophila melanogaster
Cell Line: S2
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 25
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
E75B,promoter 3L:17968342-17976094 GTGTGAGGCAATGGGAATG -
Target
Locus2 Fragment location Primer sequence Strand
EcREs,-20kb segment 20 3L:18003955-18006359 GCAAAAATTCTGACGACCTTG -

4.Reference

Link, N., et al. (2013). "A p53 enhancer region regulates target genes through chromatin conformations in cis and in trans." Genes Dev 27(22): 2433-2438.   PMID: 24240233

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.