Detail Information of gg0000057 [Genome Browser]
1.Basic Information

Name: gg0000057
Species: Gallus gallus
Cell Line: DH3
Restriction Enzyme: MboI

2.Experiment Infromation

Remark: 3-day/9-day RBCs
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HBA,enhancer 14:12108400-12108694 GGAACAAGTGTGCCAAGC +
Target
Locus2 Fragment location Primer sequence Strand
TMEM8A, intron 8 14:12115931-12116449 AGCAGAGCACATTAGACAGCA +

4.Reference

Philonenko, E. S., et al. (2009). "TMEM8 - a non-globin gene entrapped in the globin web." Nucleic Acids Res 37(22): 7394-7406.   PMID: 19820109

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.