Detail Information of gg0000047 [Genome Browser]
1.Basic Information

Name: gg0000047
Species: Gallus gallus
Cell Line: DT40
Restriction Enzyme: MboI

2.Experiment Infromation

Remark: 3-day/9-day RBCs
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PLEKHM1,promoter 27:1608484-1609084 TGCCTTCTCGTTCTTTCAACCT +
Target
Locus2 Fragment location Primer sequence Strand
Ig-beta,+4.8kb to +6.1kb segment 27:1608484-1609084 CAGTGGCCCCAGATCTACCA +

4.Reference

Minbuta, T. and M. Ono (2011). "Scattered regulatory regions of the chicken immunoglobulin-β gene and two adjacent promoters of ubiquitously expressed genes interact with the immunoglobulin-β promoter in DT40 cells." Biol Pharm Bull 34(11): 1710-1716.   PMID: 22040884

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.