Detail Information of gg0000025 [Genome Browser]
1.Basic Information

Name: gg0000025
Species: Gallus gallus
Cell Line: RBCs
Restriction Enzyme: BamHI/BglII

2.Experiment Infromation

Remark: in differentiated HD3 cells, not DT40
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hbb ρ,promoter 1:193714558-193717801 AGGGAGACTACGAATGCTGC +
Target
Locus2 Fragment location Primer sequence Strand
Hbb-bh1,promoter 1:193717796-193724856 CTGAGCCCCACCCTGATG +

4.Reference

Ulianov, S. V., et al. (2012). "Spatial organization of the chicken beta-globin gene domain in erythroid cells of embryonic and adult lineages." Epigenetics Chromatin 5(1): 16.   PMID: 22958419

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.