Detail Information of hs0000017 [Genome Browser]
1.Basic Information

Name: hs0000017
Species: Homo sapiens
Cell Line: HB2
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: similar results were obtained in MCF-7 cells
Primer amount: 6
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MYC,S-DHS 8:128322127-128327249 CTGCTCAAAAATGCCTTTGG -
Target
Locus2 Fragment location Primer sequence Strand
MYC,Promoter 8:128741351-128754071 CCATGGTCCAAAATGAGGTT -

4.Reference

Meyer, K. B., et al. (2011). "A functional variant at a prostate cancer predisposition locus at 8q24 is associated with PVT1 expression." PLoS Genet 7(7): e1002165.   PMID: 21814516

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.