Detail Information of gg0000011 [Genome Browser]
1.Basic Information

Name: gg0000011
Species: Gallus gallus
Cell Line: embryonic erythrocytes
Restriction Enzyme: MboI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CGTHBA,promoter 14:12089653-12090073 TTCACAGCACAAGGGATAACT +
Target
Locus2 Fragment location Primer sequence Strand
HBAD,promoter 14:12089653-12090073 ATGCCTACAACCTGCGTG +

4.Reference

Gavrilov, A. A. and S. V. Razin (2008). "Study of spatial organization of chicken alpha-globin gene domain by 3C technique." Biochemistry (Mosc) 73(11): 1192-1199.   PMID: 19120022

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.