Detail Information of gg0000001 [Genome Browser]
1.Basic Information

Name: gg0000001
Species: Gallus gallus
Cell Line: HH
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: at least t
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
SHOX,promoter 1:129100252-129102045 CTAAGCAAGCAGCACTTAGG +
Target
Locus2 Fragment location Primer sequence Strand
SHOX,ECS4/CNE9,segment R13 1:129100252-129102045 AGTTCTGTGCTGTGTAACCAC +

4.Reference

Benito-Sanz, S., et al. (2012). "Identification of the first recurrent PAR1 deletion in Leri-Weill dyschondrosteosis and idiopathic short stature reveals the presence of a novel SHOX enhancer." J Med Genet 49(7): 442-450.   PMID: 22791839

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.