Detail Information of sc0000045 [Genome Browser]
1.Basic Information

Name: sc0000045
Species: Saccharomyces cerevisiae
Cell Line: yeast cells
Restriction Enzyme: AluI & EcoRV

2.Experiment Infromation

Remark: in the presence and absence of inositol
Primer amount: 11
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
INO1,segment P1 X:135857-136447 GAACCCGACAACAGAACAAGC +
Target
Locus2 Fragment location Primer sequence Strand
INO1,segment T1 X:133946-134200 GTTGAGGTAGATGCGAGAAAGTG -

4.Reference

Moabbi, A. M., et al. (2012). "Role for gene looping in intron-mediated enhancement of transcription." Proc Natl Acad Sci USA 109(22): 8505-8510.   PMID: 22586116

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.